Introduction

Banana is a renowned and the most consumed staple fruit on the planet, especially in Pakistan. It is grown in more than 90 countries mainly in Brazil, Ecuador, North-America, Japan, Philippines, Colombia, China, India and Costa Rica (Varma and Bebber 2019). In Pakistan, the area under its cultivation is 352 thousand ha with an average yield of 31.4 MT ha^-1 (Rehman et al. 2018). With an increase in urbanization, it is becoming an important cash crop serving as the sole income source to the poor farmers to eliminate the poverty (Memon et al. 2016). The fruit is usually curved with a soft flesh rich in starch covered with an enhanced variation of rind which may be brown, green, purple, red, or yellow when ripe (Fu et al. 2018). It is a rich source of nutritional antioxidants including potassium, manganese and vitamin B and C. Banana consumption plays a major role on human health in reducing the risk of colorectal cancer, asthma, diabetes, leukemia, high blood pressure and cardiovascular diseases (Ghag and Ganapathi 2018).

Being a perishable fruit, its commercial production is severely affected by post-harvest losses up to 40–45% due to improper handling, inadequate harvest, lack of proper packing skills, insufficient storage conditions and many other uncontrolled factors (Selvaraj et al. 2019). Banana plant is attacked by a number of fungal pathogens namely Fusarium roseum, Botryodiplodia theobromae, Fusarium semitectium, Fusarium moniliformae, Colletotrichum musae, Lasiodiplodiat heobromae, Verticillium theobromae and Trachysphaera fructigena causing blossom end rot, cigar-end rot, Fusarium wilt, crown rot and anthracnose disease (Kuyu and Tola 2018; Shen et al. 2018; Vilaplana et al. 2018). The genus Curvularia is comprised of more than 75 species, most of them are facultative plant pathogens responsible for pre-harvest and post-harvest yield loses in economically important crop plants (Bengyella et al. 2019). Curvularia lunata is one of the most destructive ubiquitous pathogens responsible for stem blight, leaf spot, leaf blight, root rot and necrotic rot in rice, spinach, strawberry and switchgrass (Gupta et al. 2017; Bisht et al. 2018; Liu et al. 2019). The accurate identification of C. lunata has been very confusing because of morphological similarities among the culture isolates depending upon the growing conditions making it doubtful, incorrect or remains unresolved (Kusai et al. 2016). Recent studies have shown the importance of molecular identification as these do not correlate with morphological identification. Molecular studies by using the polymerase chain reaction and DNA probes are gaining importance worldwide for the rapid and specific detection of C. lunata for ensuring the quality of fruits, vegetables and cereals (Santos et al. 2018; Lu et al. 2019). The objective of the present study was to identify the post-harvest pathogen of banana rot in Pakistan through morphological and molecular characters.

Materials and Methods

Sample collection and identification

Banana with greenish grey to dark green, dry, sunken and decayed lesions of rot were collected from the local market of Lahore, Pakistan. Diseased portions were surface sterilized in sodium hypochlorite (3%) for 1 min with three subsequent washings with distilled water and placed on malt extract agar (MEA) containing plates for 5 days. After that, pure culture was obtained by placing the young fungal mycelia, obtained from the colony margins, and incubated at 28°C for 7 days. The mature fungal colony was identified on the basis of its macroscopic features (colony size, shape, texture, exudates and color) and then examined through microscopic characteristics (conidia and conidiophores) under a light microscope at 4, 10, 40 and 100X magnifications.

Scanning electron microscopic (SEM) analysis

Seven-day-old C. lunata culture was processed according to Jinfeng et al. (2017) with some modifications before SEM analysis. The sample was cut into 1 cm³ pieces and placed in vials containing 4% glutaric dialdehyde followed by three washings in 0.1 M cacodylic sodium trihydrate buffer. Next, the samples were fixed in osmium tetraoxide (1%) for 1 h and washed again with the sodium trihydrate buffer with a subsequent dehydration process in pure ethanol and then passed through acetone. The sample was then placed on a stub for further analysis under electron microscope (Jeol JSM-6480 LV).

Molecular characterization

The genomic DNA of C. lunata was isolated by using CTAB method (Doyle and Doyle 1990) and run PCR with ITS and GAPDH primers given in Table 1. Amplified products were subjected to MiSeq Illumina sequencing, USA and submitted to NCBI (National Center for Biotechnology Information) database for BLAST search tool to perform the homology comparisons with other isolated sequences of C. lunata by using Clustal W software (Thompson et al. 1994). On the basis of aligned sequence data, a neighbour-joining tree was constructed by using MEGA X software (Tamura et al. 2012).

Pathogenicity test

For the confirmation of C. lunata attack on banana fruit, a pathogenicity test was performed on five surface sterilized banana fruits. The fruits were inoculated by using an inoculation needle carrying fresh mycelia of C. lunata grown on MEA. Fruits in control treatment were inoculated with sterile MEA and placed in autoclaved beakers for 7 days. After the confirmation of pathogen establishment, the C. lunata conidia were re-isolated from the lesions developed on banana and their morphological characters were studied.

Results

Morphological identification revealed that the fungal colonies were fast growing on malt extract agar with an average diameter of 8 cm in 7 days of inoculation at 28°C. The young colony was greenish grey in color which upon maturation turned into downy dark grey to black with a blackish grey reverse on MEA (Fig. 1). The microscopic examination of the fungal growth revealed that the conidia were single or in the form of chains attached with brown geniculate conidiophores distinguishes by septation with dark brown scars. The apical part of conidiophores was flexuous to straight, unbranched and septate. The mature conidia were 19.8 to 27.3 × 7.3 to 11.8 µm in size, distinctly curved at subterminal ends, ellipsoidal with rounded ends, dark brown to reddish brown in color with smooth conidial walls having 3 oblique septa.

All the inoculated banana fruits showed rot symptoms after 7 days of inoculation (Fig. 2). Initially, small sized dark green sunken lesions appeared on the banana surface which later on expanded by joining together. The fungal pathogen was re-isolated from the infected banana fruits on MEA plates producing the same characteristic features.

The genomic DNA of C. lunata was amplified by using two sets of primer pairs viz., ITS and GAPDH generated single fragment PCR products shown in Fig. 3, with MN752153 and MN787829 accession numbers, respectively, resulted in 100% identity match. The obtained sequences were aligned by constructing a phylogenetic tree with each of the individual primer ITS (Fig. 4A) and GAPDH (Fig. 4B) by using a neighbor-joining method in MEGA X software.

Discussion

Table 1: List of oligonucleotide primers used for the characterization of C. lunata at molecular level

Primer name	5´ to 3´ sequence	Amplicon size (bp)	Annealing temperature
ITS 1 Forward	TCCGTAGGTGAACCTGCGG	~637	60°C
ITS 4 Reverse	TCCTCCGCTTATTGATATGC
GAPDH Forward	CAACGGCTTCGGTCGCATTG	~561	60°C
GAPDH Reverse	GCCAAGCAGTTGGTTGTG

Fig. 1: (A)- Mature colony of Curvularia lunata on MEA, (B)- Colony reverse on MEA, (C)- Conidia at 4X, (D)- Conidia at 10X, (E & F)- Conidia at 40X, (G)- Conidia at 100X, (H & I)- Conidia under scanning electron microscope showing conidiophores bearing conidia separately and/or in chains

Fig. 2: Pathogenicity test. (A)- Symptoms of rot in naturally diseased banana, (B)- Control banana (no inoculation) which is symptomless, (C-G)- Typical symptoms of Curvularia lunata after inoculation on banana

Fig. 3: Agarose gel electrophoresis, (M): 1 kb DNA standard marker, (1): Genomic DNA of Curvularia lunata, (2): ITS1/ITS4 amplified PCR product, (3): GAPDH_f/GAPDH_r amplified PCR product

Fig. 4: The ITS (A) and GAPDH (B) gene sequences of the C. lunata isolate from this study was aligned with C. lunata sequence isolates from GenBank using Clustal W© program. The phylogenetic trees were constructed using the neighbor-joining method in MEGA X version 10.1 (Tamura et al. 2012)

Major fungi associated with rot decay are Curvularia lunata, C. verruculosa, C. tuberculate, C. brachyspora, C. clavata, C. trifolii, C. coicis, C. inaequalis and C. spicifera (Pei et al. 2018; Pornsuriya et al. 2018; Wang et al. 2019; Balamurugan et al. 2020). Among them, C. lunata, the dematiaceous mold is considered as the most virulent strain responsible for fruit rot in Carica papaya, Ziziphus mauritiana, Solanum lycopersicum, Fragaria ananassa, Hylocereus polyrhizus, Malus pumelo, Mangifera indica, Phoenix dactylifera and Citrus sinensis on a large scale (Bussaban et al. 2017; Bisht et al. 2018; Helal et al. 2018; Majumdar and Mandal 2019). Similarly, in the present study, the pathogenicity test with C. lunata revealed that it is the most pathogenic isolate also capable of inducing rot on banana fruit.

According to Santos et al. (2018) pathogen accuracy on the basis of morphological and microscopic characteristics alone poses a diagnostic dilemma because of the absence or infrequent morphological patterns of conidia and conidiophores. In such critical situations, molecular methods provide a great assistance towards their accuracy (Edgar 2018). There are many efforts in this regard to develop such molecular tools for the accurate identification of the pathogens. Wurzbacher et al. (2019) reported that ribosomal DNA of C. lunatais composed of internal transcribed spacer (ITS) region with major 18S, 5.8S and 28S transcripts. The ITS region is the best DNA marker with high amplification success rate widely used in molecular taxonomy because of elevated variations to differentiate the fungal isolates at inter or intraspecies level (Badotti et al. 2017). In addition, the use of some other secondary DNA markers such as GAPDH is essential for better speciation process within the genus Curvularia (Kiss et al. 2020). The reason for selecting glyceraldehyde-3-phosphate dehydrogenase region specifically was that it is highly constitutively expressed in Curvularia species making it a successful heterogenous gene for the best screening experiments (Silva et al. 2017). In previous studies, molecular test with ITS and GAPDH primers were generally used for the confirmation of C. lunata (Zhang et al. 2017; Xu et al. 2018; Liu et al. 2019). These markers have also been used for identification of species in many other genera including Alternaria, Aspergillus, Fusarium, Wallemia, Colletotrichum, Pythium, Botrytis, Cochliobolus and Ramularia (Moslemi et al. 2017; Garfinkel and Chastagner 2019; Janbozorgi et al. 2019; Raza et al. 2019).

Conclusion

On the basis of rDNA sequence of C. lunata with the corresponding amplified DNA products, morphological, microscopic and molecular phylogenetic results, we believe that C. lunata is the first report of banana rot in Pakistan.

Author Contributions

IHK did experimental work and wrote part of paper. AJ supervised the work and also wrote a part of the paper.

References

Badotti F, FSD Oliveira, CF Garcia, ABM Vaz, PLC Fonseca, LA Nahum, A Goes-Neto (2017). Effectiveness of ITS and sub-regions as DNA barcode markers for the identification of Basidiomycota (fungi). BMC Microbiol 17; Article 42

Balamurugan A, K Sakthivel, A Kumar, M Muthamilan (2020). First report of Curvularia hominis inciting fruit rot of ridge gourd (Luffa acutangula) in Tamil Nadu, India. J Plant Pathol 102:529–529

Bengyella L, S Iftikhar, K Nawaz, DJ Fonmboh, EL Yekwa, RC Jones, R Roy (2019). Biotechnological application of endophytic filamentous bipolaris and curvularia: A review on bioeconomy impact. World J Microbiol Biotechnol 35:69

Bisht S, R Balodi, A Ghatak, P Kumar (2018). Determination of susceptible growth stage and efficacy of fungicidal management of Curvularia leaf spot of maize caused by Curvularia lunata (Wakker) Boedijn. Maydica 61:5–9

Bussaban B, P Kodchasee, S Apinyanuwat, C Kosawang, N Jonglaekha (2017). First report of Curvularia lunata causing leaf blight on mulberry (Morus spp.) in Thailand. Plant Dis 101:1951–1951

Doyle JJ, JL Doyle (1990). Isolation of plant DNA from fresh tissue. Focus 12:39–40

Edgar RC (2018). Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences. Peer J 6; Article e4652

Fu X, S Cheng, Y Liao, B Huang, B Du, W Zeng, Z Yang (2018). Comparative analysis of pigments in red and yellow banana fruit. Food Chem 239:1009–1018

Garfinkel AR, GA Chastagner (2019). Survey reveals a broad range of fungal pathogens and an oomycete on peonies in the United States. Plant Health Prog 20:250–254

Ghag SB, TR Ganapathi (2018). Banana and plantains: Improvement, nutrition, and health. In: Bioactive Molecules in Food. Reference Series in Phytochemistry. Mérillon JM, K Ramawat (Eds.). Springer, Cham, Switzerland

Gupta S, A Dubey, T Singh (2017). Curvularia lunata as, a dominant seed-borne pathogen in Dalbergia sissoo Roxb: Its location in seed and its phytopathological effects. Afr J Plant Sci 11:203–208

Helal RB, S Hosen, S Shamsi (2018). Mycoflora associated with post-harvest disease of papaya (Carica papaya L.) and their pathogenic potentiality. Bangl J Bot 47:389–395

Janbozorgi S, M Mehrabi-Koushki, R Farokhinejad (2019). New records and hosts of the Curvularia species in Iran. Rostaniha 20:1–13

Jinfeng EC, MIM Rafi, KC Hoon, HK Lian, CY Kqueen (2017). Analysis of chemical constituents, antimicrobial and anticancer activities of dichloromethane extracts of Sordariomycetes spp. endophytic fungi isolated from Strobilanthes crispus. World J Microbiol Biotechnol 33:5–24

Kiss N, M Homa, P Manikandan, A Mythili, K Krizsan, R Revathi, S Kocsube (2020). New species of the genus Curvularia: C. tamilnaduensis and C. coimbatorensis from fungal keratitis cases in South India. Pathogens 2020; Article 9

Kusai NA, MMZ Azmi, S Zulkifly, MT Yusof, NAIM Zainudin (2016). Morphological and molecular characterization of Curvularia and related species associated with leaf spot disease of rice in Peninsular Malaysia. Rendic Linc 27:205–214

Kuyu CG, YB Tola (2018). Assessment of banana fruit handling practices and associated fungal pathogens in Jimma town market, southwest Ethiopia. Food Sci Nutr 6:609–616

Liu Z, T Liu, D Chen, J Hou (2019). First report of Curvularia lunata causing leaf spots on Partridge tea [Mallotus oblongifolius (Miq.) Mull. Arg.] in China. J Plant Pathol 101:439–439

Lu Y, Y Song, Z Xue (2019). Multiplex polymerase chain reaction detection of Curvularia lunata, Bipolaris maydis, and Aureobasidium zeae in infected maize leaf tissues. J Basic Microbiol 59:862–866

Majumdar N, NC Mandal (2019). Screening of different botanicals extract on two polyphagous postharvest pathogens from mango and banana. J Pharmacogn Phytochem 8:4253–4256

Memon IN, H Wagan, S Noonari, MH Lakhio, BA Lanjar (2016). Economic analysis of banana production under contract farming in Sindh, Pakistan. J Market Consum Res 21:14–21

Moslemi A, PK Ades, T Groom, ME Nicolas, PW Taylor (2017). Alternaria infectoria and Stemphylium herbarum, two new pathogens of pyrethrum (Tanacetum cinerariifolium) in Australia. Aust Plant Pathol 46:91–101

Pei YL, S Tao, YF Sun, TZ Feng, HB Long (2018). First report of Capsicum frutescens leaf spot caused by Curvularia lunata in China. Plant Dis 102:241–241

Pornsuriya C, SI Ito, A Sunpapao (2018). First report of leaf spot on lettuce caused by Curvularia aeria. J Gen Plant Pathol 84:296–299

Raza M, ZF Zhang, KD Hyde, YZ Diao, L Cai (2019). Culturable plant pathogenic fungi associated with sugarcane in southern China. Fung Divers 99:1–104

Rehman A, Z Deyuan, I Hussain, MS Iqbal, Y Yang, L Jingdong (2018). Prediction of major agricultural fruits production in Pakistan by using an econometric analysis and machine learning technique. Intl J Fruit Sci 18:445–461

Santos PRRD, EU Leao, RWDS Aguiar, MPD Melo, GRD Santos (2018). Morphological and molecular characterization of Curvularia lunata pathogenic to andropogon grass. Bragantia 77:326–332

Selvaraj MG, A Vergara, H Ruiz, N Safari, S Elayabalan, W Ocimati, G Blomme (2019). Al-powered banana diseases and pest detection. Plant Meth 15:92

Shen Z, CR Penton, N Lv, C Xue, X Yuan, Y Ruan, Q Shen (2018). Banana Fusarium wilt disease incidence is influenced by shifts of soil microbial communities under different monoculture spans. Microb Ecol 75:739–750

Silva AO, DC Savi, FB Gomes, FMWR Gos, GJ Silva, C Glienke (2017). Identification of Colletotrichum species associated with postbloom fruit drop in Brazil through GAPDH sequencing analysis and multiplex PCR. Eur J Plant Pathol 147:731–748

Tamura K, FU Battistuzzi, P Billing-Ross, O Murillo, A Filipski, S Kumar (2012). Estimating divergence times in large molecular phylogenies. Proc Natl Acad Sci USA 109:19333–19338

Thompson JD, DG Higgins, TJ Gibson (1994). CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucl Acids Res 22:4673–4680

Varma V, DP Bebber (2019). Climate change impacts on banana yields around the world. Nat Clim Change 9:752–757

Vilaplana R, L Pazmino, S Valencia-Chamorro (2018). Control of anthracnose, caused by Colletotrichum musae, on postharvest organic banana by thyme oil. Postharv Biol Technol 138:56–63

Wang H, L Xu, Z Zhang, J Lin, X Huang (2019). First report of Curvularia pseudobrachyspora causing leaf spots in Areca catechu in China. Plant Dis 103:150–153

Wurzbacher C, E Larsson, J Bengtsson-Palme, SV den Wyngaert, S Svantesson, E Kristiansson, RH Nilsson (2019). Introducing ribosomal tandem repeat barcoding for fungi. Mol Ecol Res 19:118–127

Xu G, F Zheng, R Ma, FQ Zheng, L Zheng, XF Ding, CP Xie (2018). First report of Curvularia lunata causing leaf spot of Pennisetum hydridum in China. Plant Dis 102:2372–2372

Zhang W, JX Liu, PH Huo, ZB Nan (2017). Curvularia lunata causes a leaf spot on carpetgrass (Axonopus compressus) in China. Plant Dis 101:507